Nature, Količina 429Sir Norman Lockyer Macmillan Journals Limited, 2004 |
Iz vsebine knjige
Zadetki 1–3 od 76
Stran 273
... performed essentially as described25 . Prehybridizations and hybridizations were performed in 50 % formamide , 5x SSC , 5x Denhardt's solution , 1 % SDS , and 100 μg ml- ' boiled herring - sperm DNA at 42 ° C . The following [ y - 32P ] ...
... performed essentially as described25 . Prehybridizations and hybridizations were performed in 50 % formamide , 5x SSC , 5x Denhardt's solution , 1 % SDS , and 100 μg ml- ' boiled herring - sperm DNA at 42 ° C . The following [ y - 32P ] ...
Stran 302
... performed according to the manufacturers ' protocols . Primers used for reverse transcription ( RT ) -PCR were as follows : mLIV1 ; 5 ' - AAAAATCCTAGAACTAGTCTAGGGAAAGGA - 3 ' ( sense ) , 5 ' - CCTTCAGCTCCTCTCGAGAGTAGCGCTGGC - 3 ...
... performed according to the manufacturers ' protocols . Primers used for reverse transcription ( RT ) -PCR were as follows : mLIV1 ; 5 ' - AAAAATCCTAGAACTAGTCTAGGGAAAGGA - 3 ' ( sense ) , 5 ' - CCTTCAGCTCCTCTCGAGAGTAGCGCTGGC - 3 ...
Stran 317
... performed on each ~ 500 - bp segment as shown in Fig . 1b . Assembly reactions contained each primer at 30 nM and 1 x ExTaq mix ( Takara ) in a total of 25 μl . Amplification reactions contained each outer primer at 0.5 μM , 2.5 μl ...
... performed on each ~ 500 - bp segment as shown in Fig . 1b . Assembly reactions contained each primer at 30 nM and 1 x ExTaq mix ( Takara ) in a total of 25 μl . Amplification reactions contained each outer primer at 0.5 μM , 2.5 μl ...
Druge izdaje - Prikaži vse
Pogosti izrazi in povedi
acid activity analysis antibodies apoptosis applications AQPO assays asteroids B-cells bioinformatics Biol biotechnology cancer candidates caspase cell biology cellular Centre climate clinical cloning COP1 core culture Department detection disease domain drug e-mail effects experience expression field function funding galectin-2 gastrulation gene genetic genome global granule cells growth human increase indicate Institute interactions Japan laboratory ligand magnetic mammalian MDMA mechanism membrane mice molecular biology molecules mouse mutant nature publishing group Naturejobs neurons Neuroscience nuclear observed ocean ORF2 oxygen photons Phys pollen pollen tubes position postdoctoral potential predicted production protein proteomics publishing group npg Rap1 rats receptor region response retrotransposition retrotransposon ribozyme RN-tre says Science scientific scientists sequence signal siRNA species stem cells structure Supplementary Fig surface target temperature tissue transcription transfected transgenic University wild-type